Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14721E4
Clone ID IST14721E4
Vector VICTR76
Project tigm

Sequence tag IST14721E4BBF1
Sequence
TGCTTTAAAAAGAAAATGTGAGCTTCTTGGGAAATCACCATTAGCCACCAAATTTCAAAGTAAATAGCCCCAGAGGCAAG
GCACAGAGGCTAGAAACAAAACACAAGTGGCCACTCCTGGGGAGAATTTCTATTCACATCTGTACCAGCACCAGACACAG
CTTGACACCCAGTAGGCACTTAATAAAACTGTTTGCAGGCTATGAGATGGCACAGTGGAAGATTGCAAGCTTGCTATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119029394..119029631 238
 
EST/CDNA Est Name
  BB801336.1 - BY794890.1 - BY048311.1 - AI157807.1 - AA111429.1


Sequence tag IST14721E4HMR1
Sequence
CATGTGTATGTGTCTATTGTTCGTGTGCACATGAATGCAGGTGCCTGCACAGGCCAGGCACAGCGAGATTACAGGTGGTT
GTGAGCCACCTGATGTCGGAGCTAGGAACTGAATTTAGGTCCTCTTTAAGATCTTACCTGCTGAGCATCTCTAGCCCCAA
AGCTTACATTTTCTAATGATGATTAATTAATGATGATTGATGATTTCAACAGGCACATGCCATGCATAAAGTGGGAATTC
TTCTAACCAATCTTCANTAAGGTCAAGAATTAAAGCTTGTAATAGCTGTCATGGTTTGAAGGTGGATANACATCCATGTA
NAACAGCCTGCAGTGCTGTGAACTGTAAACGTGTCNNTANTCTTTGAACGTACAGGCAGGTGTGGCTNANGACAGGAACT
TTGGANTCNNGACTGCCTGANGATGGTTTATGACTTANCCCNNNAGTGGCCGTGANCNGTTN
Sequence Type genomic DNA
Unitrap ID UNI2177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119028935..119029395 425
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034278 (Dnajc17) NM_139139 DnaJ (Hsp40) homolog, subfamily C, member 17 Gene [Source:MGI (curated);Acc:Dnajc17-001]


Sequence tag IST14721E4HMF1
Sequence
ATGCTTTAAAAAGAAAATGTGAGCTTCTTGGGAAATCACCATTAGCCACCAAATTTCAAAGTAAATAGCCCCAGAGGCAA
GGCACAGAGGCTAGAAACAAAACACAAGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119029393..119029503 111
NO GENE  

 
Come back to gene ENSMUSG00000034278


For any suggestions or comments, please send an email to unitrap@crg.es