Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10194C9
Clone ID IST10194C9
Vector VICTR76
Project tigm

Sequence tag IST10194C9HMF1
Sequence
TGATTTCCAGCACCCACATGGCAGCTTACAACTGTCTGTAACAACAGTTTCAAAGGCTCTCATACTCTCTTCTTGCCTCT
GTGGGCACCAGGCACAAATGGTTCATAGATGTACATACAGGCAAAATATCCATACATATAAAATAATAACAAAAACTTAT
TAAAGCCAAGTCTACAAAGTTTTAAAACTTTACATTTAAACCTTAAAATTCTTTCAAATTACTGAANAACTGATTTGCAG
CACAGTGATGTTCATTGTTGTATTGTATACTTCTAATTTGTTACATACTTCTAATTTGTTACATTCCTATGACTGCTTTC
TCATTGCTACCTCACAGCGAATCTTCCTAGTTCATATTCATGGTCTCTCTACCTTCTACTCCCTCTGTCTGTCTGTTGGT
CTGTCCTCCCTCCTCTCTCTGGGACCCTCTCACTGGGATTAGACGTTCCACCCTATTCTCCTATTCTCTTCTACCCAGCT
AGTTGGCTNANCCTNTN
Sequence Type genomic DNA
Unitrap ID UNI11446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96130314..96130807 488
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032411 (Tfdp2) NM_178667 transcription factor Dp 2 Gene [Source:MGI Symbol;Acc:MGI:107167]

 
Come back to gene ENSMUSG00000032411


For any suggestions or comments, please send an email to unitrap@crg.es