Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14617B12
Clone ID IST14617B12
Vector VICTR74
Project tigm

Sequence tag IST14617B12HMR1
Sequence
NTTTGTTTGCATAGTGTATATATTATGCCTGGCTTGCTACCATAGGTTTATAATCTGAGCTACTTGAGAGGCTAAGGCAG
GATCATAAGTTGGTCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI1536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108174754..108174851 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]


Sequence tag IST14617B12BBF1
Sequence
CAAACAAAAGTCAATTGGGATCTAGCTCAGTGGTAGAGTGCTTGCCTAGCAAGTGCAAGGCCCTGGGATTGGTCCTCAGC
TCTGAAAAAAATAAAAGTAGGTAGCCTCAGCTGGGGATATCCTATATATATCAAGCCAACTGGAGCTGCCCACTTAAGAC
CCTGTCTCAAGAAGACAAAGGAGCCCTCAAGTAGTTCAATCAGTAGAGAGGACTTGGTTTGATAGATACTAAACACTGGG
TTTGAATCTCAGAACCATATAAACCATGCAAAGTGCCTCCAACCTCAGCACTCAGAAGATAGAGGCAGAAAGACTGGAGC
TCAAGGCCAGCCTGAGGCTACAAGAAACCAAGGAAAGAAAACAGGAAAGTAATAAAAGGAGGGAACAGTAGCACCAAGTT
TTTACTGGCTNAAAACAAATNTTTTTTTGANCCNGGCNTGGCGCACACCTTTAGTCCNANCNCTCGGNNNGCANAGGCNG
GCAGATTTCTGAGTTCNAGGCTNGCNTGNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108174247..108174757 477
NO GENE  


Sequence tag IST14617B12HMF1
Sequence
CAAACAAAAGTCAATTGGGATCTAGCTCAGTGGTAGAGTGCTTGCCTAGCAAGTGCAAGGCCCTGGGATTGGTCCTCAGC
TCTGAAAAAAATAAAAGTAGGTAGCCTCAGCTGGGGATATCCTATATATATCAAGCCAACTGGAGCTGCCCACTTAAGAC
CCTGTCTCAAGAAGACAAAGGAGCCCTCAAGTAGTTNAATCAGTAGAGAGGACTTGGTTTGATAGATACTAAACACTGGG
TTTGAATCTCAGAACCATATAAACCATGCANAGTGCCTCCAACCTCAGCACTCANAAGANAGAGGCANAAAGACTGGAGC
TCANNCCAGCCTGAGGCTACAAGAAACCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108174408..108174757 332
NO GENE  

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es