Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10172G5
Clone ID IST10172G5
Vector VICTR76
Project tigm

Sequence tag IST10172G5BBF1
Sequence
CAGTGAGTGAGACACAGTTTCTGTGANACAGACCNGGGTTGGGGTTGTGGGGGACTATGGATGTATGGATGTGTCTTGCT
GATGATGGGGCTGCCCCGGTTCAGGCCACATCCTCTCTCAACAGTCAGTTCCAGGACTGAGTGCAGGTAACACCACCTGT
CTCTAACCNGCCTTGTCCTGCAGAGAGAACTGCACCTTCAGGCATGGCCTGCACTTTTGTTCTTGAACCTGGTGCTCAAC
AGGCCCTAAGAAGCAGCCCTCTGACAAGGTCACCATGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35737953..35738235 277
NO GENE  


Sequence tag IST10172G5HMF2
Sequence
NAGCCAGTCCTATCTATACAAAGAGTTCTNGGGTANCCCGAAGTACATAGTGACCCTGTCTGTGAGAGAGACAGAACAGA
GGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGANANAN
Sequence Type genomic DNA
Unitrap ID UNI24143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87437774..87437927 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es