Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6986-NL
Clone ID PST6986-NL
Vector U3NeoSV1
Project escells

Sequence tag PST6986-NL
Sequence
CATGTAGACTATGTGTGACGCAGGATCAGATGCCTAGAAGTAGACTTTTATGTAGGAAGGACT
Sequence Type genomic DNA
Unitrap ID UNI14950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94869013..94869074 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028126 (Pip5k1a) NM_008847 phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha Gene [Source:MGI (curated);Acc:Pip5k1a-002]

 
Come back to gene ENSMUSG00000028126


For any suggestions or comments, please send an email to unitrap@crg.es