Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST8546-NR
Clone ID PST8546-NR
Vector U3NeoSV1
Project escells

Sequence tag PST8546-NR
Sequence
ATATGTACACATATGTGTATGTGTGAGTATATTTGTGTATGTGATGTATGAGTGTGCATG
Sequence Type genomic DNA
Unitrap ID UNI14953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103229972..103230031 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032555 (Topbp1) NM_176979 topoisomerase (DNA) II binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920018]

 
Come back to gene ENSMUSG00000032555


For any suggestions or comments, please send an email to unitrap@crg.es