Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14650E1
Clone ID IST14650E1
Vector VICTR74
Project tigm

Sequence tag IST14650E1BBF1
Sequence
CTGGGAAGCTAAACACACTGGGCAAGCAACTCTGAGCTACTGGGCTACATTTCCCAGCCTGCTTTCCTTTTGTTTTTATG
TTTGTTTTTATTTTGAGACTTGGTCTCACTAAGCTATCCAAGGTTGGACTCCATTTAACTCTGTATCCCAGACAGGCCTT
GAACTTGGAATCCTCCTGTCTCAGCCTCCAGACTATCTGGGATTACAGGCCTGAGTTTCTGAGCTTGGCCAAATGCCACC
ATTTCATCCCAACACTAGTTACAAGGACACAAAAAGGTAGTAACTTANNCTTCCTCTCTGTTTTATTTTTAGCTTTGTTT
TTTTTTTTTTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109866245..109866574 326
NO GENE  


Sequence tag IST14650E1HMR1
Sequence
NNGGGGAAAGTANCATTGGGTATTTAACTGTGAGAAGGTATTTGGAAAGAAAGTCAAGAGATTTGATTCTCTTATCAGCT
AGTGGTATGGAAGTGAACCTAGAGTCTTGAAGATGGCAGGCTGTACTCTATCGATGAATTATATCCTCAGCCCTAGTAGC
ATACATTTTTGAGTGCTCTAAAGAGAACTTTATCACCTTTCTATTGGCAAAATGATGATTTTTCAAGATCTAAGATAAGA
TCATTGGAGTAGTGACTGTGGCCTTTGAAGTGTATCCAGCAGTTTCATGGACTACGAAGGGATAATCTCCTTCCTTCTCT
CCTGTCTCCTTTCCTTTCNTTCTCTCTANGAAAGATCNTGCTGAAGTTNANANCCNCNTGCCNTANCCNCCN
Sequence Type genomic DNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109866574..109866962 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]


Sequence tag IST14650E1HMF1
Sequence
CTGGGAAGCTAAACACACTGGGCAAGCAACTCTGAGCTACTGGGCTACATTTCCCAGCCTGCTTTCCTTTTGTTTTTATG
TTTGTTTTTATTTTGAGACTTGGTCTCACTAAGCTATCCAAGGTTGGACTCCATTTAACTCTGTATCCCAGACAGGCCTT
GAACTTGGAATCCTCCTGTCTCAGCCTCCAGACTATCTGGGATTACAGGCCTGAGTTTCTGAGCTTGGCCAGCCACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109866344..109866574 231
NO GENE  

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es