Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0434
Clone ID XS0434
Vector pGT0lxf
Project sanger

Sequence tag XS0434
Sequence
TTCGTCATCCTCTCTCTCCGCATCCCCTGACTTCCTTACACTCCACCCGTTCATGGTCTGATTAATTCGTTCCTGCCCAT
CCCCCACACAATTTGCTCCCCTTCGCTCCTCTATCATCTACCATCCCCGCTGCCCTGGCCTCCCCCTTCCTAATTGGAAG
GTGAACGCAGCGTTTGCTGCGCGCTACAGCCGTTACCGCGAGCGTGAGGAACTTCAGCGACGTGAGTGAGGGGCGCCTGC
GCAGGCCAAGGTGTGGGGAACTGGGTCTGGTGATGGTAGCTATGAGGAACCCCGTGTATATTCCACAGTGAAAGATCGCT
ATGGAGATCCGGACGTCGGTGGGGACTCCAGTTCTGAGTCTGACTCCAGCGATGAGCAGGTGC
Sequence Type mRNA
Unitrap ID UNI2550

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21092143..21092367 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035047 (Kri1) NP_663391 KRI1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2384899]

 
Come back to gene ENSMUSG00000035047


For any suggestions or comments, please send an email to unitrap@crg.es