Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14389G6
Clone ID IST14389G6
Vector VICTR74
Project tigm

Sequence tag IST14389G6HMF1
Sequence
GGGTGACAACTCTGGAGCCTAAATCGCACGTGGCATTCAGCCGGCGCGGAGCCTGGAAATCGGGTACCGGCATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI34748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174111489..174111566 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027523 (Gnas) NM_019690 GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus Gene [Source:MGI (curated);Acc:Gnas-007]


Sequence tag IST14389G6BBF1
Sequence
GGGTGACAACTCTGGAGCCTAAATCGCACGTGGCATTCAGCCGGCGCGGAGCCTGGAAATCGGGTACCGGCATGGCCAAT
TTGGGGCCGCGGGACCCTGGAGCCAGTGCCTCCCCCCACGCCGTGCAAGTAGTCTTGGTTAATACCGCTCACCTCTGGAG
GTTCGAGGAGGCCTGAGATCGTGAAAAGGGGCGCGCGCACCTCTCCCGTGCGTCCTAAAGCCAACCTTCCCGCGCAGAAA
GGAGTTTCTTGATAGTGGATAGTGCTTGGAGGACACTCAGTGGTGGTATAGGGTTCTTTACGGGTGCCCTTCTGGGCTAC
CTGGGTTGGCAGACAGCTAGGATCACATCGGGGTATCGCGCANCTGGTTAGGCAGATCCNACTTGTCCGGANANGTCCGG
GACTGTGCGCCTN
Sequence Type genomic DNA
Unitrap ID UNI34748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174111489..174111900 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027523 (Gnas) NM_019690 GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus Gene [Source:MGI (curated);Acc:Gnas-007]

 
Come back to gene ENSMUSG00000027523


For any suggestions or comments, please send an email to unitrap@crg.es