Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14591A7
Clone ID IST14591A7
Vector VICTR74
Project tigm

Sequence tag IST14591A7HMF1
Sequence
ACACAACTGTTCTGTCTTGGGCTGTGTGAGGACCATCTTGTGCTCTGTGCTACTCANCAACACTGACCCTCTACTCTCAA
GCTCTGGGCCGCACACACAACCCTCANACCTCCCTAAAATGCTGCACCAGGGANCAGTCATCACCAAATGGGGACCCAGT
GCTCCANCCNACAGGTCTAAGCCTTGGTGCAATCCACTGTGGGGTTGTTTGTTTAGTTCTATTTTTGAAACANAATCTTG
TGTGTATCANGCTGGCCCTGAACTCCACANCANCCATGCATCTCCATGCCCAATCTCAATACACATCTAATAATCTTATG
AAATTTTACATTTTATATTCCCACAGTATTCACACACAAATTTTCCTTCTATNNNNATNNNTCCTTNNNTTTGTGTACAC
TANGCTANCCAGCCTGCNNNANANTCTCTTGTCTCCACCCNCATCTTCCCATAANANGGCTGGGACTGCGCANTTCGGTG
CCTGCNNNAANTGCACCTCTTTGTGTTCTGANTCNTATGNNTNNANTNATCAAAGAAAAGANACACTGCNNGANGANNTT
NNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14591A7HMR1
Sequence
TGTCAGCCAGGCTGAGGTTGAGAAACCCAGCTCTAAGATCAAAAGACCTAGGACACCCCTAAAGAATTTAAAATAATTTT
GTGCAAAATATCTCATAATATGGAAAGAGGGAAACATATCAAACTCACCTCCTGTGACAGGATGTTTTACAGCTAATTAT
CTCCATAAAGGATCATGGCTTAATTGAGATGACGTAAGCGTTATCATAGATGAGGGAAGGTTCTCAGGANAGTGGTCCAT
GGTGCACAGTCCCATTCACTAACAGTGGGCACAGAATGCTGGACGCTGCCTGANCATCACAGCTGCAGCCCCTCCAGCCT
CGCTGTGCTTCANCCNTGAGTTTACACAGGAGGGGCCNCCTGGATGCTGTGANCCNNTGTGANCCTTGATANGTGGNGTT
CCANTGNNAANATN
Sequence Type genomic DNA
Unitrap ID UNI10719

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28521187..28521599 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]

 
Come back to gene ENSMUSG00000037640


For any suggestions or comments, please send an email to unitrap@crg.es