Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6807-NR
Clone ID PST6807-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6807-NR
Sequence
CAGGGATCTGAACTCTCATCCATACTGGGCCCAGAACCAGGGCCTTCACATG
Sequence Type genomic DNA
Unitrap ID UNI14725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52974249..52974300 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059070 (Rpl18) NM_009077 ribosomal protein L18 Gene [Source:MGI (curated);Acc:Rpl18-001]

 
Come back to gene ENSMUSG00000059070


For any suggestions or comments, please send an email to unitrap@crg.es