Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14747F6
Clone ID IST14747F6
Vector VICTR76
Project tigm

Sequence tag IST14747F6HMF1
Sequence
CTGGTGTCCGGGCTACAGCCTGGCGTGCTATCCCAGAAGTGACTTCCTGCGGAGCGAAGTCTACCAGAATACAGATTTAC
ACAGAAGTGTTTACTCTGCCCTCCGTTTCCTTTATCCCATCCCACATTGCCTAGGTAACAGTGTCTGTGGTCACCCATAC
CTGGATGGAAGGACATGGGGGGAAGATTATGTCTTCATTTTGGTTTGGATTGGTGACCTCTAAGATCTTTCCCACTCTTC
AGATTCGTATTTAGTCTCGCCGAGACTATTCTGGGTACCTAAAGATTAAATGAGGAGAAACTGACCGACCTTCCCAAGGC
CTTTCTGTACTCATATCTTATATGTTGGGCACATTGGTGCTCTAAATCAGGATTAGTGCAGTGCTCTGAAAGCAGTCAAC
G
Sequence Type genomic DNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112333613..112334012 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]


Sequence tag IST14747F6BBF1
Sequence
ATGGAGACTAACGGCGGCGCCTGGTGTCCGGGCTACAGCCTGGCGTGCTATCCCAGAAGTGACTTCCTGCGGAGCGAAGT
CTACCAGAATACAGATTTACACAGAAGTGTTTACTCTGCCCTCCGTTTCCTTTATCCCATCCCACATTGCCTAGGTAACA
GTGTCTGTGGTCACCCATACCTGGATGGAAGGACATGGGGGGAAGATTATGTCTTCNTTTTGGTTTGGATTGGTGACCTC
TAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112333593..112333840 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]

 
Come back to gene ENSMUSG00000003604


For any suggestions or comments, please send an email to unitrap@crg.es