Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10046C9
Clone ID IST10046C9
Vector VICTR75
Project tigm

Sequence tag IST10046C9HMR1
Sequence
CCATGTTTNAAAATGGTAACAGCTTGATGAAATTTAAAAAGTAACAGAACAAAAGAGTTACAAATTAGGCACTTTTCAAA
TACATTAGTGGAAAGGATCTCAGGTGGTTTTAAAGTGAAGTAGGGAAAGCTCTGCTGTAGATCCCTGATGCTATTTGATG
CTTAGTGCAAACTAACCGGCTGTTAAAGAAGTCCAAAAGAGTTTGCTGTTAGCCAGAAGGATAAAAAGATAGCTCAGGGG
CCGGAGAGATGACTCAGCGGTTAAGAGCATCAACAGCTTTTCCAGAGGTTCTGAGTTCAATTCCCAGCAN
Sequence Type genomic DNA
Unitrap ID UNI143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87947266..87947574 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036934 (4921524J17Rik) NM_025722 RIKEN cDNA 4921524J17 gene Gene [Source:MGI Symbol;Acc:MGI:1913964]


Sequence tag IST10046C9BBF1
Sequence
ACCTGGGACAACTGAAGAGTAGCCAAGCTTAGGGTACTGTGTATCCCCTCTATTCTTAGGTGCGCCGACCCTGGAGGAGG
TGGGTTCTTCTGGGAAATGCGTTTACTATGAGGGTGCTTGCAAGGAGCTCACAGTCCAAGACAAAATGGTCTTAAAATGT
GGCTGTCACTTGTGAATAAGGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117053813..117053999 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es