Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13549D11
Clone ID IST13549D11
Vector VICTR74
Project tigm

Sequence tag IST13549D11HMR1
Sequence
NTGTTCCATACATTTTTGTCTCAATAAATACATGTAAGAACTAATGAAGTTTTTGTTCATTTGTTTTAATTTTTAAGTGA
GCATTTATTACAGGGGCTGGAGAGAGAGATGTTCAGCGGTTCAGCGCATTTGTTGCTCTTGCAGAGGACTCGGGTTCAAA
TTCCAGCACCCACATAGTGGCTTTCAGCCATCTGTAGCTTCAATTGGAAGGACCCAATACCCTCTTTTGGTTTCCACAGA
TATTGTCACACACAGTGGTACACAGACCTACGTGCAGGCAAAACATCCGTAAACAGATATTTTGAAAGTTACCTTTATTT
ATTGTGTCTGTTGGGAGAGTGAGTCATATACATAGGTCAATGGTGCGTATGTGGAAGTCAGAGGACACATGGGGGAATCA
GTTCTTAANNCTATGTGGGTCCCANGATTGAAGCCCANTCCTCAGCCTTGGTGGCNAGTGCAN
Sequence Type genomic DNA
Unitrap ID UNI18902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125641682..125642142 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]

 
Come back to gene ENSMUSG00000029478


For any suggestions or comments, please send an email to unitrap@crg.es