Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14752-NL
Clone ID PST14752-NL
Vector U3NeoSV1
Project escells

Sequence tag PST14752-NL
Sequence
TGAGTGTAGGTGGCTAATACACGTGCTGTGTGGGTGGAAAG
Sequence Type genomic DNA
Unitrap ID UNI14963

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116826807..116826846 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047675 (Rps8) NM_009098 ribosomal protein S8 Gene [Source:MGI (curated);Acc:Rps8-001]

 
Come back to gene ENSMUSG00000047675


For any suggestions or comments, please send an email to unitrap@crg.es