Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10875G9
Clone ID IST10875G9
Vector VICTR76
Project tigm

Sequence tag IST10875G9BBF1
Sequence
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTAN

Sequence Type genomic DNA
Unitrap ID UNI32944

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166479: 5701..5740 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166462: 18619..18658 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166335: 18008..18047 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166338: 10898..10937 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166340: 38929..38968 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166442: 40860..40899 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036925 (Spt1) NP_033293 salivary protein 1 Gene [Source:MGI Symbol;Acc:MGI:98392]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166286: 3259..3298 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166290: 17600..17639 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_053651: 22100..22139 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166468: 49248..49287 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166455: 6427..6466 40
NO GENE  


Sequence tag IST10875G9HMR1
Sequence
CACACACACACTCACACACACACACACACACACT
Sequence Type genomic DNA
Unitrap ID UNI31160 UNI32994 UNI34429 UNI34761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5514540..5514573 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 32535784..32535817 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 78255643..78255676 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31588440..31588473 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8701477..8701510 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8942255..8942288 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 63799354..63799387 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 25911173..25911206 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13502927..13502960 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031925 (Maml2) NP_001013835 mastermind like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2389460]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 11937034..11937067 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 21583501..21583534 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 36859513..36859546 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6232510..6232543 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28584910..28584943 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21890133..21890166 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 67245685..67245718 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7918487..7918520 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19950078..19950111 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060090 (Rp2h) NM_133669 retinitis pigmentosa 2 homolog (human) Gene [Source:MGI (curated);Acc:Rp2h-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3691747..3691780 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026655 (3110001A13Rik) NM_025626 family with sequence similarity 107, member B Gene [Source:MGI Symbol;Acc:MGI:1913790]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 57129164..57129197 34
NO GENE  

 
Come back to gene ENSMUSG00000026655


For any suggestions or comments, please send an email to unitrap@crg.es