Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14939F12
Clone ID IST14939F12
Vector VICTR76
Project tigm

Sequence tag IST14939F12BBF1
Sequence
CAGGTGACGGTATCTCTAGGACCTTCAGCAACTCTGAATTCTTACATCCTGGTGTAGAGAGCCTCTCTTCAGAGGCATGA
CCCTGACTCTGAAGCCCCAGCACCTCCCTCCTTTAAAACCAGTGTCTTGATCACACGAATGTCATTCCTGTTCCCCAGGC
TTCTAAGCACGGGGCAGGCTGACCCAGCAGAGTCTTCAGCCCATCTTCTCCCTGGTGTTTGGGGCTGCATTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101957806..101958041 236
 
EST/CDNA Est Name
  BY022021.1 - BY789605.1 - BY787212.1 - BY787244.1 - BY129488.1 - CF904850.1 - BY144268.1 - BY137848.1 - BY781742.1 - BY304961.1


Sequence tag IST14939F12HMR1
Sequence
ACCTGCACTGAAAACGCTCACTGTGTGAAAAGAGAAACAACAGGAGCGACTGAGAACTGCTGAGTAGCAGGTGTTTCTCT
GCCTCAGCACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI29572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101957717..101957810 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es