Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14666B4
Clone ID IST14666B4
Vector VICTR74
Project tigm

Sequence tag IST14666B4HMF1
Sequence
CTACAAGGATNAATACTCCTCCACTGGCTCTCACAGCTTCGGANCCCAGCACCCTGAAAAATCCCTTCCTGGANCCCATC
AAGCACCGCCTCCGGAAAGCCGCCAAGTGGGCCTCGTTAAGACGTGCAAGGAGCAGAGCCGTGGGAAGGCAACGTANCTC
CAGAGGGCCACCTCGGGGCTCCAGATCGCGTACCCATCCCTGCCCGGACCCCCGCAGCCNCCCGGGTCCCCAGGCTCTGC
CGATTCTTTGTTAAACNANGCCNANGTTCCTCCGCCCTCGCCAGGCCCCAGTTACCTCTCGTGTCCCCCGGGCTAGCGGC
ACTGCNTCTGGCNAGCCCTTCACCCAAACCCGCTGCCGNGGCTGCAGACGCAGTTGCTACTCCAGTCGGCGCGAAANANC
CCCCGCGGCCCTGCNTACGCNCGGTGNNGNACCGCNTNCAGCCGCNCNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14666B4HMR1
Sequence
TAGGTAGCTGTTGGGGATTGCGGACCCACAAATGGAGGCGGGGAGGGTCTCGGTAGCGGAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI6873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106078763..106078826 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020705 (Ddx42) NP_082350 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 Gene [Source:MGI (curated);Acc:Ddx42-001]

 
Come back to gene ENSMUSG00000020705


For any suggestions or comments, please send an email to unitrap@crg.es