Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12822H9
Clone ID IST12822H9
Vector VICTR76
Project tigm

Sequence tag IST12822H9BBF1
Sequence
ATAACAATTATCAGAAATCTTTTCGTAATTGCCATCTGTACACAGGGAACTGCAGTGGTTCAAAGTGAGGCACTGAANAC
TANAGAGGAANGGANGAGAGTGCGTGGCAAATGGCAAATGGCAAGAACGTGGTTGTAGTTTGGTAGCCTCAGGTGAAGGT
TAGGAGCCAAACAAGATAGAAAAGCGCCGGGCAATGGTGGCGCACGCCTTTAATCCCAGCATTCGGGAGGCANAGGCAGG
CGGATTTCTGAGTTCGAGGCCNNCCTGGGTACAGAGTGAGTTCCAGGACAGCCNGGGCTACACAGANAAACCCTGTCTCA
AAAAACAATAGATAGAATAGCATCCCTGGGGAANGTCANTCTGGGTATGTANTGTCAGANCTCAATTATAAGATGGGGAN
AANCAAGGGATCTTTGTAAGGAAAGTANTAACATTGGCAATGGGAAATTCATTATAAAACTGAAGAATGAANAACGTCNG
TAAATATGTTN
Sequence Type genomic DNA
Unitrap ID UNI34765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86586716..86587205 454
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]


Sequence tag IST12822H9HMR1
Sequence
GTTATNATCACAGAATCTGTATCACATCTTCAGTCTTTAAGTTGCTTAGCACTGCAGTTAGATACAGTAGTGTCTATCAA
CTCTCTCAAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86587201..86587291 89
NO GENE  

 
Come back to gene ENSMUSG00000018425


For any suggestions or comments, please send an email to unitrap@crg.es