Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11629D5
Clone ID IST11629D5
Vector VICTR76
Project tigm

Sequence tag IST11629D5HMR1
Sequence
GAGCTCCAGGGCAGCCTGGACTACAGAGAGAAATCCTACCTCAAGAAACAAAACAAAATTTTGCAAAAATCATTTTGAAA
GAGAAATTGCCTGTGTCTCAAGAGAAGAATGGGTTGGGTGTTACAGTCAGCCTGCAGGATGTAAATTCTTGAAACATCAC
AGCANCATTTTTATNNCNNCNTANAAGTAGGGGGTGGGGTGAAGGAAAGAACNNCNNNGANNTNANCNNTGACTTANTAG
GANNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11629D5HMF1
Sequence
AAAGGCGTGAACTCTCCCACACCTGGCTTATTTTTGCAAGTTTAATTTCCAACAGAGAAATGTTATAGTGTTATTCCAAA
CCTGGCACCTGCCCCAACCCCCCCCCAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI28989

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7498789..7498903 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039278 (Pcsk1n) NM_013892 proprotein convertase subtilisin/kexin type 1 inhibitor Gene [Source:MGI (curated);Acc:Pcsk1n-001]

 
Come back to gene ENSMUSG00000039278


For any suggestions or comments, please send an email to unitrap@crg.es