Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10610D1
Clone ID IST10610D1
Vector VICTR76
Project tigm

Sequence tag IST10610D1BBF1
Sequence
CAACTAAACAGGTGACAGCAAAGTCCTCAAAAGACTGGATCAAACAAGCTCTCANTATTCTTTTGATTTTCTTACTTTTT
TAATGTTTGATGTGTGTGTGTGTTGCCTGCATGTGTATCTGTGCATCATGTGCATGTCTTGTGCCGGGAGGCCAGAAGAG
GTTACATACAGCANGTTGTGAGCTACTATATGGGTGCTGGGAATTGAACCTGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94830540..94830755 212
NO GENE  


Sequence tag IST10610D1HMR1
Sequence
GTTGAGACCNTTCAGTTTGTAAGTAGCAGTATGAATGTTACAGGCAAATAGTATGAAGCAGAGATGAATACAGCTGTTTC
TATGGCTCAGAGCTAGAGACTGAATTGATACTTTGTCTGTAGTTCTTAGTATCCATGCCAGGAGACAGACATTACTGAAG
CAAAGATGGCATGAAGTAAACAGACGTACCTAATGGCACTGGTTCCGTTGTTTTAAAAGCAAAACTGTCATGATGGTTCC
TTTATTGCTCATGGACTCGCCTCTTCATGCACTTGGTGACTCATCCGAAATGGCTGTCCTCTANCAGGAGGTCNNGAATA
NANGCN
Sequence Type genomic DNA
Unitrap ID UNI14917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94830752..94831076 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074897 (CT030190.9) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3USJ7]

 
Come back to gene ENSMUSG00000074897


For any suggestions or comments, please send an email to unitrap@crg.es