Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11047F1
Clone ID IST11047F1
Vector VICTR76
Project tigm

Sequence tag IST11047F1HMF1
Sequence
CTGTGAGTGATTTTCTGAGGCAGGGGGATGACTTGAGACAAGATGTGTGTGCTGCTGCACCTTCACTGGCTTGGGAGCTT
CTAGAGAGTCTCATTTCCAAGTAGGGGCACATTAGGATTAGAGCCACTTGCACAACTGTGTCCAGTGCTTGTAAGCACCA
AAGCATCTCTCTAGCCCTCTAAACGTTCTTGACTGGCTGAAGGAGAGTCTAACTGAGGATGACAGTTTATTCACTGTTTG
GAAATAGTTTTGCCTTGTGCATATTATCCTCAAACTTCTTGGCTTTGAGAATAAAACCCAGGAGCAGTGAACATGCCAGA
GTAATGTATATTTNAAAACTTATTTTATTATTAATATGTTTTTCTCTCTCTCAAGACTTAGTTGTAGGAGCTTTTGGTGT
GGATCGAGCTGTCTTATACAGGTATGTTGCATATACTTTAATACAGGAATATTTTAAATTATTTGAAAAATGTTTAAGTA
TTCNTTTGAATTTCAGTTTGNNTTTCTTATAGTGACAAANNNATNCTAN

Sequence Type genomic DNA
Unitrap ID UNI34766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 83618828..83619323 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027087 (Itgav) NP_032428 integrin alpha V Gene [Source:MGI (curated);Acc:Itgav-005]

 
Come back to gene ENSMUSG00000027087


For any suggestions or comments, please send an email to unitrap@crg.es