Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10834B3
Clone ID IST10834B3
Vector VICTR76
Project tigm

Sequence tag IST10834B3BBF1
Sequence
TTGTTACCATTCTTCCAGAGGGCCACTAATTAGGTATAATGAAAGAACGTGGGAACGGAAGTTGAAACCGCCATTCACCA
GCTGTGTAACACTGTGCCTGGCGATCAATCATCAGGCAGTGTGAAGAGGTTATAAGGATAGGTAACTGTCTCAAAATTAA
NAGAGACTTGTAAACAAGCACTTCTATTACAAAGTGAAGAGCGCTGCAACCTANNTCGGCCCCAAGAGCTTGGTGGCCGG
GTGCTAACCTNNNTTTGGGNGGANCAAAAGAGATGACNNCAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108505500..108505786 267
 
EST/CDNA Est Name
  CN689383.1 - AA041651.1 - BY157021.1 - CB272417.1 - BE192665.1 - DV551682.1 - AA033421.1 - CB237706.1 - BI790825.1 - BY766300.1 - AL363566.1 - BY170174.1 - BY264566.1 - BY135086.1 - AL363298.1 - AA792641.1 - BY307514.1 - AA433786.1 - BY140412.1 - CO797687


Sequence tag IST10834B3HMR1
Sequence
NAATAGTTACCAACTACTGAGTGTCTTACCTGAACTTGATAATCTATGCTTTAGCCTTCAACTCAGTAN
Sequence Type genomic DNA
Unitrap ID UNI30278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108505435..108505501 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028568 (Btf3l4) NM_027453 basic transcription factor 3-like 4 Gene [Source:MGI (curated);Acc:Btf3l4-001]

 
Come back to gene ENSMUSG00000028568


For any suggestions or comments, please send an email to unitrap@crg.es