Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14298F2
Clone ID IST14298F2
Vector VICTR74
Project tigm

Sequence tag IST14298F2HMR1
Sequence
GCCNAGCTCTGTGGAGCCNTTGAAAGAGCACCATCCTTGGGCAACTGGCGACCAGGGTGTTTTCCTTTTANATTTACTAC
ATATCCATAGAAGGAACTTCCGGGAGGTGAGAACATTCGTGATTCNGCTCTTCTCCAGTTCCCTCAACTCACCCTTCTTT
AGCTGGCATACAAATTGGCACTCAGTTGATACCCANAAAACACTGACNCGAACGCTCTTGACTTATCAATCACAAGGANC
GTTTGAATGAANCAAATGTTTCANAATANAGGCTGGTTCTGCTCTTGGTANGGTCCCNNGN
Sequence Type genomic DNA
Unitrap ID UNI9030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40774274..40774570 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028413 (B4galt1) NM_022305 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI (curated);Acc:B4galt1-001]


Sequence tag IST14298F2BBF1
Sequence
GGCCATTGATNAGCCTTTCTNACGCCCCTGCTCCCCTCTGCACCGCTCTCTCACCTCATCATGCCCCCAATACATGGCGA
GTACCTCACCCCACACTCTTTTCCCTGGGGCAGTTCTTTCCCACCCCCACCTCTGACACCCCATTCCAGAAATTATGCAG
CTCACGCCTCTCCAGTGAAGAGGGCACAGCAGCAGCAGGCCCATAGGCGAATGCCTCCTCGGCTCCAGTGTCGGCCAGGA
AGCCGCANACCTGCTGCCATACTGTANGGGCTAGCCTCCACTACATACCCAGCTATACCGCANTGAGAAAAATCCNAGGA
ACTAGACTCTGANGTGGACACTCANGGGTTCCTTAGAAAGTCNGTTGGATGGTGTTATGCNNNNGCNNACGCGTGAAGGA
ATGTTTNNGCTGANNCNNNCACNNGANANGACNTTCTGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028413


For any suggestions or comments, please send an email to unitrap@crg.es