Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14423B3
Clone ID IST14423B3
Vector VICTR74
Project tigm

Sequence tag IST14423B3HMF1
Sequence
TTTTTTTCNCTCCCGCCAACCTCCCCCCCCACTTGTGTCCCATTTGCGGCTTCATGGAGGTACTTCTGCAGCTTGCCTTG
AGGTCCCGAATGGTTTCATCCTCACTGCTGCGTGGGACTTGGGGAAGGACACCTGAAGTGTTAATAAGCTATAACATTGA
TTCCATGGCTGGGTTGAGACATGAGGGGTTCAGAGGAGCTGAGGGACAGTGCCAGACAATGCTGGAGGACCATAGCCACA
GCTATTAGCAGTTAAATCGCCATGAGTAGATTTAGATCACCACCACCCTCCCCTTTCTGGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTNTNTNTNTN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30917311..30917630 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14423B3BBF1
Sequence
TTTTTTTNACTCCCGCCAACCTCCCCCCCCACTTGTGTCCCATTTGCGGCTTCATGGAGGTACTTCTGCAGCTTGCCTTG
AGGTCCCGAATGGTTTCATCCTCACTGCTGCGTGGGACTTGGGGAAGGACACCTGAAGTGTTAATAAGCTATAACATTGA
TTCCATGGCTGGGTTGAGACATGAGGGGTTCAGAGGAGCTGAGGGACAGTGCCAGACAATGCTGGAGGACCATANCCACA
GCTATTANCAGTTAAATCGCCATGAGTAGATTTAGATCACCACCNCCCTCCCCTTTCTGGTGTGTGTGTGTGTGTGTGTG
TGTGN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30917316..30917630 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es