Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10910E1
Clone ID IST10910E1
Vector VICTR76
Project tigm

Sequence tag IST10910E1BBF1
Sequence
ACCTTTGTTGTAGAGATTGGCTAGGAGAGTTGTGGCTCTGGAATTTGTATGAAGACTGTTGAATTGTGAGTGAATAGAGT
ATTCCTTACGATTTTTGTCGTTAATACATTTCTTCTCAGGAACAAAACAAAACTCCATCANAGTGCTCCCATATAAAAGA
ACAATGTACCTTTGGAGGCAGGAATCTAAGAGCATANGAATGCANTTTTTCTGGTTTCCTTTTTATCTTTACNGGAACTG
ATAATGTATTCTTTTTTCAATTGTGAATTAAATTTCTACATTTTTGTTTAAAATGTCTCTAGTAGGATGCTAGAGGATCT

Sequence Type genomic DNA
Unitrap ID UNI27547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89808086..89808404 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]


Sequence tag IST10910E1HMR1
Sequence
GGTAGCCTTTAGGAGTNAAGTTCACAATCNTTTAGAATCTTCCAGTAGAATGTTTGTCTTTAAAGGTTAAAGATTTAGTC
AATGATTAAGTGCTTGTCTAGCCTGAAAGACCTCTAGCACCGAGGGAAAAGAATTTAACTCTTAAACCCCACCACAACAC
AAGTTCTAATAGTGCCCTTCAGAAGGAACAAATATAATCTAGGAGGAAAAAAAAGCACAGAACCACAGAAATAAAGCAAG
ATTAACTGCATACTTGGAAGGCACAGAGTAAACAAAGGGAACAATACAACAAACTCTTTTGGAGGTAGCANANATCTCCT
TCTCTTTTCANACCCAATTTCTATCTGACAGAACAATGGGTAGCAGGCATAACTTTAAGTTCAGCTNTGAAAGGGGCTAA
AGCTAGTCNNAGGTTTGATGTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89808402..89808823 406
 
EST/CDNA Est Name
  BQ565608.1 - BE623771.1 - BE448014.1 - AA445197.1 - BF018429.1 - BG146010.1 - BU743408.1 - BF182281.1 - BE198737.1 - CX733391.1 - BF472397.1

 
Come back to gene BQ565608.1 - BE623771.1 - BE448014.1 - AA445197.1 - BF018429.1 - BG146010.1 - BU743408.1 - BF182281.1 - BE198737.1 - CX733391.1 - BF472397.1


For any suggestions or comments, please send an email to unitrap@crg.es