Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11053B4
Clone ID IST11053B4
Vector VICTR76
Project tigm

Sequence tag IST11053B4HMF2
Sequence
GTGCCTGCAGCGGCCCTTAGAGGTCAGAAGAGGGTGTTGGACCCTGGAAGTAGAGTTACAGGCTGCTGTGAACTGCCATG
CGGGTGCTGGAAACTGAACTCAGGTCCTCTGCACGAGGAAGAAAAAAATATTCTTTACAACTGAGACATCTCTCCAGCCC
TGCCTATGGTGGAGTTTTTGTTTGGTTTGTTTTGAGACAGGGTCTCACATATCCCAAGTTGCTCTCAACGTTGCTGTGGC
ACCAAGAATGTCCTTGAACTCCGGATCTTCCAACCTCCACCTCCCTAGTGCTGGGTGTACATGTGTGCACTGCCGTTCTT
GGCTGAAATTCTTCATTTTGTGAAGTCTTGGTTGTTGTGTAAGTCTCTTTCCTTAGTGTCCGTGTTGTGACAGAATGCGT
GCTTTANTATGTCTGTGTANGGCAAAACATTTGTATATTTATTTGCTTCAAACGTTGGACTGGTGTGNTTTTTTTCCTTG
CCTCTAAGACAAGCTCTTGCTTATGTGACAGCCGTTTTCTCACTGAATGNANAGNNACTGGTAATACTTNNTGCTNNTTA
TAGCATTN

Sequence Type genomic DNA
Unitrap ID UNI32953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30967361..30967927 545
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST11053B4BBF1
Sequence
TTGTAGACTTCTATTTCAATTTATGACTTGATTTTTTTTGTGTGTGTGTGTGAACTTGTGATGAACTTTGTAATGCAATC
ATGTATTCTGAGGGGCCTATAAGTACTGAGGACTAAGAGAGCAGCAGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108559676..108559806 131
NO GENE  

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es