Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST11824-NR
Clone ID PST11824-NR
Vector U3NeoSV1
Project escells

Sequence tag PST11824-NR
Sequence
GTGACCATACTGTCTCTTCCTGTGACTCTTTGTGCATGC
Sequence Type genomic DNA
Unitrap ID UNI14975

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71557611..71557648 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064263 (Gm1631) NP_958754 gene model 1631, (NCBI) Gene [Source:MGI (curated);Acc:Gm1631-001]

 
Come back to gene ENSMUSG00000064263


For any suggestions or comments, please send an email to unitrap@crg.es