Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15067D5
Clone ID IST15067D5
Vector VICTR80
Project tigm

Sequence tag IST15067D5BBF1
Sequence
CTGCCAACCAAGTTCTGCTGCTTACTAGAGCTGAAGAAGGCCCCCTTCTTCTATTACATTATCAGAAGCTTTCTGTTTTC
CAAATCCCTTACTGCCTATGCTTGGCTGCCTTAAAACTTGCTCTGTAGATTGACCTTGAACTTANAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506495..108506646 150
NO GENE  


Sequence tag IST15067D5HMF1
Sequence
CTGCCNNCCNAGTTCTGCTGCTTACTANAGCTGAAGAANGCCCCCTTCTTCTATTACATTATCANAANCTTTCTGTTTTC
CAAATCCCTTACTGCCTATGCTTGGCTGCCTTAAAACTTGCTCTGTAGATTGACCTTGAACTTAGAGATCTGCATGCCTC
CTCCTCCTGAGTGCTGGGATTAAAGACTCCTACCACCACACTTGACCACTATGCCTCAAAATCCGGATCAAAAAAGCCTG
TGTCTGGATCACATGTGCTCTACATTTCTGGACTATATATAGTTCACTCCACATAAAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506344..108506646 289
NO GENE  


Sequence tag IST15067D5HMR1
Sequence
AGAAGGGACAAGACTACTGGGACAATTGATGCTGGTTAGCTAGAGCTAGGAAGTTCACGGTGATTAAGAAGAGACCAGCA
TCATTGAAGTGAAATCTGGGAAGTGTTTTCAGAGAGCACAAAGGAGCCTGTGTTCCATTAATAGCCAAGGTTGTAGCTCA
TGTTTCAGCTGGAATTGGTAGTGTGTAAGAGATACCCAGGTGGACTGATTTTGAAGTTATGAAGGGGTCATGGAGAGCAG
CTGAGGTTAGGCACTGTGAGAGGCTAGGAGAGGCCATCGTTGAAGGTACAGCCTTAGTGACATTTGAAGACCCAGGACTG
AAAGGACCATGCNAAAGAGTTGAGGCTTGGTNNTGTGAAGANAANCCTATTGATNAAGCCTANTTGCAACGGAAGANACT
TGTGTATTGGAGATACCAGTNCCATCN
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506682..108507106 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es