Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13696G4
Clone ID IST13696G4
Vector VICTR74
Project tigm

Sequence tag IST13696G4HMF1
Sequence
ATGGGTGTGTATGTGTACCTGAGTCCAGGTGTCTGTGGAGGCCAGAGTCACTGACATAAGTGGCTGGGAACTGAATTCAG
GTCCTCTANAANAACAGTACAGGCTCTTGAATTCTCTCTTTGGTCTTCCTCCCCTTCTGATGTGTATGGATATTCTGCTT
GCATTGCATATATGTCATATGTAGCATGTGCATGCCTGGTGTCTACTGAGGCCNAAGGAGGGCATTGAATCTTCTGGAAC
TGGCGTTATAGATGGCTGTGAGCTGCCNTGTANGTTCTGGGAATCAAACCCANGTCCTCTGGAANANCANCCNNTACTCT
TAAAATCTGANCCNACTTTCCAGCCTTGATGCTTGGCTTTAAAATGTTTTTCTCTTGANGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84849758..84850138 353
NO GENE  


Sequence tag IST13696G4BBF1
Sequence
CCCATATGCAATACAAATTTTGTTGTTTGAACATCTTCAGAAACATTCCGTAAGAAAAGCAGTTTTCATTTATGTCCTCT
TTGACCGCTCCAGCTGTTCCTGGCGGGGAAGTTGCTTTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI26449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102943006..102943130 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es