Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST11483-NR
Clone ID PST11483-NR
Vector U3NeoSV1
Project escells

Sequence tag PST11483-NR
Sequence
TTCTGGGCCTAAAGTATTTGAATGTTTTTATGTTGAAGAGCTGATAGGATTTGCATGC
Sequence Type genomic DNA
Unitrap ID UNI6697

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50194023..50194080 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007850 (Hnrph1) NM_021510 heterogeneous nuclear ribonucleoprotein H1 Gene [Source:MGI (curated);Acc:Hnrph1-005]

 
Come back to gene ENSMUSG00000007850


For any suggestions or comments, please send an email to unitrap@crg.es