Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0378
Clone ID XS0378
Vector pGT0lxf
Project sanger

Sequence tag XS0378
Sequence
CATCCCGATCCTTCGTACTCCTTTGTTTTCCCCAGGTCTCTACTCCGCTCCCCCAGCCTGTCTCTCCGAGTCCCCCGGAC
CGCCACTTTGTCCCTCGTCATTTATGCCGATCGATGGACGTTACGTGCGGTTCACACTGACGGTATTATAACAACTTTAT
GCGGATGCTAGCGAAGTTTGATATTCTAAGAACTTCGCTTAGGTTCTGCAACAATGAGTTCTTCTTGCGTTCACCATCTG
CGTGGTAATGTGACCAGATAGCCTCTGCCGCTTTCTCCTTTGCCAGTTTCCATGAAATCTTACGGATTATCTCTCACTAC
TGCTGCCCTAGCAGCTTCTTCGGGTTCTTGACCCGATGCAAAGATGGCGCCAAGATGAAGACGCTGTTGAACAAGGCAAT
TCACTTCTATGAGTCTTTAATAGTAAAAGCTGAAGGAAAAGTGGAATCAGATTTCTTTTGTCAATTAGGTCACTTCAATC
TCTTACTGGAAGATTATTCAAAAGCATTGTCATCTTACCAGAGATACTACAGTTTACAGACTGACTACTGGAAG
Sequence Type mRNA
Unitrap ID UNI2559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 560940..582173 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068457 (Uty) NM_009484 ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome Gene [Source:MGI Symbol;Acc:MGI:894810]

 
Come back to gene ENSMUSG00000068457


For any suggestions or comments, please send an email to unitrap@crg.es