Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10979-NL
Clone ID PST10979-NL
Vector U3NeoSV1
Project escells

Sequence tag PST10979-NL
Sequence
CATGTGTAATGCAAATATACTTATATACATTTATATATACTTATATGTAAAATGTAGATGG
Sequence Type genomic DNA
Unitrap ID UNI14976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6222205..6222265 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006740 (Kif5b) NM_008448 kinesin family member 5B Gene [Source:MGI Symbol;Acc:MGI:1098268]

 
Come back to gene ENSMUSG00000006740


For any suggestions or comments, please send an email to unitrap@crg.es