Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13248A10
Clone ID IST13248A10
Vector VICTR74
Project tigm

Sequence tag IST13248A10HMR1
Sequence
GAGGCAGGAGGATCTGGAATTCNAGGCTAGTCTGGGCTACACACAAGTTTGAGGGCCTGCATGANACTCAGTTTCAAATA
GAAATAGGTACATCTTGGTCATTCAGGTGTTTGAACCCAGAGATGTGTGATTCTTTTCTCCCCAGGACTGGCTTTGAGCT
CTTTGGTGACTCATCTTCTCGACTTCAGTACCCCACCCAGCTAATTCCCTTTCANTGAATTAGTTTCTCCCTGCTGTTGC
TCTTATCTTCCACTCCATCTTGAGCAAATTCTTACTGAATCACTCAACTCCAAGCCTAGTTAGCAACTGAAGTACACAAC
ACAGGCCCTGGGCCTGCTCAGCTCTCCTCTCCTANCTGTCTCTGCTTTAAACCTTTGCTGGGGTCTAGTGCTTTAANGAC
TGATACCTAANCATTTTCACTTGTGTATGTGTNNGGGTGTGTGGATGTGGGGGACTCGTNCNGN
Sequence Type genomic DNA
Unitrap ID UNI15525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86240447..86240905 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005481 (Ddx39) NM_197982 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI (curated);Acc:Ddx39-001]

 
Come back to gene ENSMUSG00000005481


For any suggestions or comments, please send an email to unitrap@crg.es