Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10227-NR
Clone ID PST10227-NR
Vector U3NeoSV1
Project escells

Sequence tag PST10227-NR
Sequence
GAACTAAACGGCAGTGACACAAGGTGGAACACCTTCCACTCCATAGCCTCCCCTGAAGCATG
Sequence Type genomic DNA
Unitrap ID UNI14978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113279840..113279901 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]

 
Come back to gene ENSMUSG00000031750


For any suggestions or comments, please send an email to unitrap@crg.es