Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14193B6
Clone ID IST14193B6
Vector VICTR74
Project tigm

Sequence tag IST14193B6HMF1
Sequence
AAGTGAAGATCACAGGAATACTGTAATGCCTTCTAAAAGCTGTGAAACTGAGCACATACAGAGACATCTTAAAGCTGTAG
TCCCTTGATGCAAAGTACAAGGTAAAGGAAGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13178604..13178715 112
NO GENE  


Sequence tag IST14193B6BBF1
Sequence
AAGTGAAGATCACAGGAATACTGTAATGCCTTCTAAAAGCTGTGAAACTGAGCACATACAGAGACATCTTAAAGCTGTAG
TCCCTTGATGCAAAGTACAAGGTAAAGGAAGTGGAAAATAAGGACATAGAATAGCCCCTTAAACTCTAAGAAAGGAGGGT
TTGAAGCTGCTGACATACCTTTTTAGGAAGAGGTTCTTCNTTGGTCATCTTGCACCCTGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13178604..13178823 218


Sequence tag IST14193B6HMR1
Sequence
ACTTCTTAGCCTGTATTACATTACNATATACACACGTGAACAATTTCTGAATATTTTACAGATTTTACACACATCTATAC
ACACACATGTATGTATATGTTCCTATTTTTGCTCCTATTTTGTTAAACCCCCAGGGTTGTAACTTAAATCTATCCACCTG
AGTATTTTTCAAGGCTACACCTAATTAGTTCTTGTTTTTTTCCTTTATTTTCTAACTTTGGATGTTCTGGCTCTATAGTC
CTTTACTGANTTTAGCTATCATTACTTATAGGTAATAACACTACATGTATCCTGAAGTTCTGTTAAACAGTGTGCTATAG
GCTATGGAAGGATTTGTAATTCAGTTTGGAAAAGCGTANTGTTATATAAAATTCTGCCTAANGTTNTGGAGTCN
Sequence Type genomic DNA
Unitrap ID UNI15971

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13178215..13178607 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]

 
Come back to gene ENSMUSG00000060475


For any suggestions or comments, please send an email to unitrap@crg.es