Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12365C5
Clone ID IST12365C5
Vector VICTR76
Project tigm

Sequence tag IST12365C5BBF1
Sequence
GGTAGAAACTGCATCCTCTGCTTGTGTAAATTCGGTTACAAGTCTGTAACAGAGGTACTGAGATGTGACTGAGTCTCAAG
GCCAGGCGATCGGGATTCTGAAGAGGCATTTGCATAACTGAGCAAGAGTCTTTGCCCCACCCTTCCACGCCGACCCAAGA
CAAGGGGACAGCTCTGGGTGGGTCACCTGAAGGGCCAGGGGCCCGCCCACATCCCCGCCCACACCCACCTTGAGCGCTTC
TCATTGGGCATTCCAGCCTACCCAGCTCGGAGTTAGTTACTCCGTAAGTGTGGCCGGAACAGAGTTCGTCCATCTAAAAA
GGGAGGGGTCCAAGGAGCTGAACTCCTAGCCGCCTAGATTTCCACTGTGGCTCTGGGTACNAGTGGCAGTTTCTTCTTGG
GATTTCAGAAAGGANNCCAAGGANGAAATAGGTAGAGCGCATCGCATCGCTGTGGGCATTANGTAAGTCCTGTTTNNTGA
AATGGCTGGGATTTGTCTTTTTTCTCGTTATGANGAAAGGGANNNGGAANGGTTTGAAANCCNNCNNTTTNNAN
Sequence Type genomic DNA
Unitrap ID UNI11663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44392114..44392656 513
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]


Sequence tag IST12365C5HMF1
Sequence
GGTAGAAACTGCATCCTCTGCTTGTGTAAATTCGGTTACAANNCNGTAACAGANGNNNNGAGATGTGACTGAGTCTCANG
GCCNNGCNATCGGGATTCTGAAGAGGCATTTGCATAACTGAGCAANANNNNTTGCCCCACCCTTCCACGCCGACCCAAGA
CAAGGGGACAGCTCTGGGTGGGTCACCTGAAGGGCCAGGGGCCCGCCCACATCCCCGCCCACACCCACCTTGAGCGCTTC
TCATTGGGCATTCCAGCCTACCCAGCTCGGAGTTAGTTACTCCGTAAGTGTGGCCGGAACANAGTTCGTCCATCTAAAAA
GGGAGGGGTCCAAGGAGCTGAACTCCTAGCCGCCTAGATTTCCACTGTGGCTCTGGGTACGAGTGGCAGTTTCTTCTTGG
GATTTCAGANAGGAAACCAAGGANGAAATAGGTAGAGCGCATCGCATCGCTGTGGGCATTANNNAAGTCCTGTTTCNTGA
AATGGCTGGGNNTTGTCTTTTTTCTCGTTATGANGAAAGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es