Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14990H10
Clone ID IST14990H10
Vector VICTR78
Project tigm

Sequence tag IST14990H10HMF1
Sequence
GTCTGCACTTCAGATGTCACTTTGTCTCTTAGGGTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66547364..66547404 41
NO GENE  


Sequence tag IST14990H10BBF1
Sequence
GTCTGCACTTCAGATGTCACTTTGTCTCTTAGGGTTGGCCACATTGATTCACATGGTTTTAAATACTGAGCTACTTTTTT
TAATAGTACATGTAATATATCAGATAGATATATTATCTAATATAGATTCTTTTCTTATCAGATAGATAAGAAAGCATTGT
CCGGAGCTGGAGAAACATCACAGTGGCTAAAGCACTTGCAGGAAAGAATGAGGACTTTAGTGTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66547364..66547591 228
 
EST/CDNA Est Name
  BY336090.1 - BY329778.1 - BY330796.1


Sequence tag IST14990H10HMR1
Sequence
CAGACTAGTGTTCTTCATTCAATGGCTGTGCTTTGTGGGTTTTTTTTTTAAAAATTTATTTATTTNAG
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66547304..66547368 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es