Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST11299-NR
Clone ID PST11299-NR
Vector U3NeoSV1
Project escells

Sequence tag PST11299-NR
Sequence
TTTTTTAAAAAAATTAATTGTTTGGAGGTGGCTAGCACATG
Sequence Type genomic DNA
Unitrap ID UNI1557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52177379..52177418 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es