Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10266H8
Clone ID IST10266H8
Vector VICTR76
Project tigm

Sequence tag IST10266H8BBF1
Sequence
CTGGAATAAAAGGTGTGCGTAACCACCACTTGGCGTTTTGTTTGTTTTTTGAATACCCTCTTTTANACATCAGACTCACA
GAGTTTATTGACTAACCAACCCAGGACTCCTAACTCCATTGAGTGCTTGGGGGTCCCGAGCCAACATCTTCAGCCCAGAG
TGACTTANATTGATACNCACACNCNCACACACACACACACACACACACN
Sequence Type genomic DNA
Unitrap ID UNI20645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110001434..110001641 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]


Sequence tag IST10266H8HMF2
Sequence
GGTAAGCTGCAGAGTGTGCTCGCAGGGCACGGAGAAGGTCCCTCTGGAATGTGACAAGTGTCTTGGATTGAAGTGAGAGT
GGGTGTTGCGTGTAATTTAGGGAGGGTTCTTAACCTAGTGTCGGGATGTTTGAGAGCGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 98394161..98394300 140

 
Come back to gene Mm.34340


For any suggestions or comments, please send an email to unitrap@crg.es