Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10834C8
Clone ID IST10834C8
Vector VICTR76
Project tigm

Sequence tag IST10834C8HMF1
Sequence
GTCCAAGATACAAAAGCATTCCACTTGCCNGCCCAACATTCTGAACACATTCCACCACAGTGAATGTCTTAA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22404708..22404778 69
NO GENE  


Sequence tag IST10834C8HMR1
Sequence
GACAAAAGGACACCCATGTATAAAATTGCTCGGGGATCATGTTGTGTTTTTGATTTTTATGATCATGTTTTGTTTTGATT
TTTTTTTTAAAAAATTTATTTATTTANNAA
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22404605..22404710 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es