Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14952D12
Clone ID IST14952D12
Vector VICTR76
Project tigm

Sequence tag IST14952D12HMR1
Sequence
AGTGAAGAGGTCAGCTCAGGAACTTTGGAAAATTCCNCCAGNCCCTTCCCCTCCAGAAGGGAAAGGCTAATTACATTCCT
CAGACCACAGGGAGTGGACCAACCATCTGCCACCTGCTGGTGGGGGAGGCCCAGAGCACATAGACACATTCCTCAACCTT
T
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30449422..30449582 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]


Sequence tag IST14952D12BBF1
Sequence
CACTGATAGGCTGACCAACAAAGCTACTACCCAGGCCCAGATTAGGGGCTTTGGGCTGGCCTGCCCTAACATCTACCTCA
TCTATGAACTGAGTGTGTGAAAGGGTCGGTCTTACAGATCCAAAGCTGCAGGATTTCCATGGCACAGGACAACAACAAGA
TCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30449579..30449741 163
NO GENE  

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es