Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14261A1
Clone ID IST14261A1
Vector VICTR74
Project tigm

Sequence tag IST14261A1HMR1
Sequence
GTAGCAGTCCTTCCACCTCACGAGTCAGCTCTTTTAGTTGTCTCCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI34773

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 65549622..65549671 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 24110774..24110823 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045693 (Nlrp4e) NM_001004194 NLR family, pyrin domain containing 4E Gene [Source:MGI (curated);Acc:Nlrp4e-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 114176874..114176923 50
NO GENE  


Sequence tag IST14261A1BBF1
Sequence
CTACAGAGTATTGGACAAGATTTCATCAGAGACTGTTTTTGGCCATTCAGGCCAACTCCCCTATAGCTGTAAAAGCTTGT
GTACCTTACCTGTATGCTTATTGTTAAATGATTTTAAGAGTTAAGATCACCAATCTTGACAAGTCTTTTTATATACATTG
TAATTCCTGTCATTTAACTAATTGTGTAGATCCTAATTTAAATAAGAAATCTACTGTTATGATTTTGTTAAAAAGATTCT
GCTTATGTTTTACTGTCTGTAGAGTTAGGAAACGATCCTTGGTTTGAAAATTCAAGATTGCAAGCTTTANNAAGACTANN
TGAACTTATTAGACCTAANANATTTGTANCANCTTTGATCCTGGANATTACTGCTTTANNTGCTATTTTAACTTCCTTTA
CNTTANCCNCCACAGCCTTANTNCNGCANCNNCNNNGNGGNNNNNNTGNTAATGNCNTGCNTAANAATATCTCTGTANCT
TTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14261A1HMF2
Sequence
CTACAGAGTATTGGACAAGATTTCATCAGAGACTGTTTTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 14315..14359 45
NO GENE  

 
Come back to gene ENSMUSG00000045693


For any suggestions or comments, please send an email to unitrap@crg.es