Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059F10
Clone ID IST15059F10
Vector VICTR80
Project tigm

Sequence tag IST15059F10HMR1
Sequence
CTTTGAAATGTTATGAACTACCTCTTAAGTTACAAAGAATTGTTC
Sequence Type genomic DNA
Unitrap ID UNI17165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67671779..67671822 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024533 (Spire1) NM_176832 spire homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915416]


Sequence tag IST15059F10BBF1
Sequence
NAANAANANTCNGANNNACNACTNNGANANNTATTTNANTCNGAAACANNNANNTGTGAAATTANAAAATANGANTNNNA
NAATCGNANAAAAATTAAAAAAAATATGAAAAATTTCTCATAAATTTAAATCTTTACTTAAAAAAAGAAGCTAGTTTTAT
AATCAAACTAGCCATTTTCAGTTATTTATTTAACCATCCCCCTGGCCCACCACACAGAAATTGTGAAGCACACTGTAAAG
TTAGGGCGCATGACAGAAAGTACTGACAGCGATCTTCTGTGCATGTTCAGCANAGGTCATGCGTAACAGGCTCTACCCAT
TACACAGAAGCTGGTTCTGCCCGCCAAGGCTCTCAGGGTTCCAGANAAAGGAGCGCTTTAATTCTGTTTCTATACAGTTT
TTTTCTGNTCCCTTATAGGAAAGGCCTGACCTGGTGAGAGCTACCATTCACTGGGCGGCCTTCTGGGANGCTGGGAGGCT
GCACACTCACGGTGGTTGTACTTACATGCNCNGNTTTGAAANNGNTNNCNANTTTATTTTAAGCTGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15059F10HMF1
Sequence
AAAGAACATTCTGAAAGACTACTCTGAGACTTATTTTAGTCTGAAACAGCGACTTGTGAAATTAGAAAATAGGATTTGCA
AAATCTTATAAGAATTAAAAAAAATATGAAAAATTTCTCATAAATTTAAATCTTTACTTAAAAAAAGAAGCTAGTTTTAT
AATCAAACTAGCCATTTTCAGTTATTTATTTAACCATCCCCCTGGCCCACCACACAGAAATTGTGAAGCACACTGTAAAG
TTAGGGCGCATGACAGAAAGTACTGACAGCGATCTTCTGTGCATGTTCANCANAGGTCATGCGTAACAGGCTCTACCCAT
TACACAGAAGCTGGTTCTGCCCGCCAAGGCTCTCAGGGTTCCAGANAAAGGAGCGCTTTAATTCTGTTTCTATACAGTTT
TNTTCNGTTCCCTTATAGGAAAGGCCTGACCTGGTGAGAGCTACCNTTCACTGNGCGGCCTTCTGGGANGCTGGGAGGCT
GCNNACTCACGGTGGTTGTACTTANATGCACNGNNTTGAANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67671819..67672338 492
 
EST/CDNA Est Name
  CF733465.1 - CA566815.1 - CF738835.1 - CV559919.1 - BI730242.1 - BU611358.1 - CF534449.1 - BQ770188.1

 
Come back to gene CF733465.1 - CA566815.1 - CF738835.1 - CV559919.1 - BI730242.1 - BU611358.1 - CF534449.1 - BQ770188.1


For any suggestions or comments, please send an email to unitrap@crg.es