Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14673B10
Clone ID IST14673B10
Vector VICTR74
Project tigm

Sequence tag IST14673B10HMF1
Sequence
CTCCGCTTGATGACTTACAGAGGAAATCTTCAGGGCTGCCAATTGGCTATCAGAGCGTGGGTGGGAAGAAGGAGTTCAGA
GAAGATGCTTAGCATATACGGAAGGCCAAAGGGGAGAAGAGACAGTGGCTTGCCTACAAGACACGGGTGGAGTGATGTTG
GGGATGCAAAGTCTGGCGGAACTTGTCCCAGTGGACACTTGGCTGGCAGGATAGACTATGGTGACACACTGACCTGCACT
CATGCCTGGGAAGAGACTCACATTTCTCTTACTTTTTTAAAAAACTGACTGGCCGGGCAGTGNTGGCACACGCNTTNNAT
CCCANCNCTTGNGANGCANNNGCNNGCNNATTTCACGAGTTNNAGGCCAGCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14673B10BBF1
Sequence
CTCCGCTTGATGACTTACAGAGGAAATCTTCAGGGCTGCCAATTGGCTATCAGAGCGTGGGTGGGAAGAAGGAGTTCAGA
GAAGATGCTTAGCATATACGGAAGGCCAAAGGGGAGAAGAGACAGTGGCTTGCCTACAAGACACGGGTGGAGTGATGTTG
GGGATGCAAAGTCTGGCGGAACTTGTCCCAGTGGACACTTGGCTGGCAGGATAGACTATGGTGACACACTGACCTGCACT
CATGCCTGGGAAGAGACTCACATTTCTCTTACTTTTTTAAAAAACTGACTGGCCGGGCAGTGGTGGCACACGCCTTTAAT
CCCAGCACTTGGGAGGCANAGGCAGGCAGATTTCAAGAGTTTGANGCCNNCCTGGTCTACANANTGAGTTCCANGACAGC
N
Sequence Type genomic DNA
Unitrap ID UNI31984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63970638..63971037 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]


Sequence tag IST14673B10HMR1
Sequence
CGGAGACNAACCCCCTTCCCCAGCCCAGGTACCTTAAACTGGAAAAGACCGGTTCTGCCTTGCTTCCTTGATGCTTCCAA
ACTGTTCCTCCCTCTTCCTTCCAAAACCGCAGGCCTTGACCAGTGACTGCCCTGATCCTTCCCGCTGCTCTTCACGTCCT
CTGGTTTTTTCCTTCTATCCTTGCAGGGTTTGGCCTTATCTACTGCCCCGTACCCCCTTCCCTTCACCGGTGATTCCTCA
CTGAGTTTATAAAGTTTCCNAATGTCCCCTATCCTCTTGCTAAGATCATAAACAGTACCCACTGTANAACCTCTGCCGAA
NTGGGCTGGCACTGANANCATATCTGATGTGGTANAGGATCAGTGTGACCCCTGANACNATGACCCCTCCTGGANCCTAA
NAANGANCCGGNCTTACCTTAATGATATGGTGTGCNNCCNCATATANNCNNGTGCCCTGGANCCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032401


For any suggestions or comments, please send an email to unitrap@crg.es