Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10103D12
Clone ID IST10103D12
Vector VICTR76
Project tigm

Sequence tag IST10103D12BBF2
Sequence
AGCCCTGGCTGTCCTGGAACTCACTCTGTAAACCAGGCTGGCCTCGAACTCATAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI504

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78743745..78743804 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 77947464..77947523 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033373 (Fntb) NM_145927 farnesyltransferase, CAAX box, beta Gene [Source:MGI Symbol;Acc:MGI:1861305]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 117831796..117831855 58
NO GENE  


Sequence tag IST10103D12BBR1
Sequence
TACAGTTCCTCATGTTGTGGTGGCCCCAGCCATACTTGATAACTGTAATTTTGCTACTGTTATGAATTGTAATATAG
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29691721..29691797 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es