Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10190B9
Clone ID IST10190B9
Vector VICTR76
Project tigm

Sequence tag IST10190B9BBF1
Sequence
CAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI12672 UNI30731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20308862..20308902 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26417983..26418023 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030979..18031019 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580677..55580717 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34849562..34849602 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6042433..6042473 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]


Sequence tag IST10190B9HMF2
Sequence
CAACCACATGGTGGCTCACAACCATCCGTAACANGATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTAC
TTACATATAATAATAAATAAATCTTTAAAAAATTCATAATAAATGAAAAATAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136008590..136008718 117
NO GENE  

 
Come back to gene ENSMUSG00000068270


For any suggestions or comments, please send an email to unitrap@crg.es