Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14575D4
Clone ID IST14575D4
Vector VICTR74
Project tigm

Sequence tag IST14575D4HMF3
Sequence
CTGGGAGCCTTTCCGGGCTTGCGGCTTGGCAAGATAAAATTAGGATCCTTAACCATGACCATGAGTTTTCTGAGCTAGTA
ACTTCTTTCTGAATCTATCTTAAGGAAATAAACCAACAATGAAGATTTATATATAACTTTCAAAGAAGTGGTATTTACCA
CAGGGGGCGGGGAAGCTACAATGAGCACAAAAATAAATAAACAAATAAATAAATAAATAGCTGCATTCTAAGAGAATGCT
GTCTACTAACTTCTGGGTAAAGTTAGATGGCGGTTACTTTCTTCANAGCTGGGTGGTANCANCACAGGCCTTTAATTCCA
GCACACGGGATGTGAAAGTGGGTCTCTGANTTCGAGGTCANCCTGGTCTACANANTGANTGCCNNGACNNCCANGGCTAC
AGAGAAACCNTGTTTTGAAAAGTAAAACAAAAATTTAAAGTCNNGTTTGGTGAATCATTCCTGTAATTAATTCCNGCNCT
TGANAACTGANGCAGANNATTACCTGAAGTGTAANACCNCCCTGGGTTACATTCCAAGACCCTGTTTNCATAACATTAAN
NNANTTNNNTCNANGCNCGNNANANTNNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14575D4HMR1
Sequence
CTTNTAGAAGTAACTAAGGAGAGGGAGTGGAGACTTTGCCTCTGGTCGGAAACAATAGCAAAGAACCTGTGTTCTCTAAC
CTCTTCGGTAAATTGTTTCCCTTCCATCCGTAAACAACCTGTCCTGAAAGTATCAGCCTGAATCACAAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56867475..56867626 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST14575D4BBF2
Sequence
CTGGGAGCCTTTCCGGGCTTGCGGCTTGGCAAGATAAAATTAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114434730..114434776 47
NO GENE  

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es