Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13660H10
Clone ID IST13660H10
Vector VICTR74
Project tigm

Sequence tag IST13660H10HMF1
Sequence
NNNGCNNTTGNTTTNGTANNNNNNAAATGANNNGGGATAACCNTTTTANCTACTGCTTGGTGATGGTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13660H10BBF1
Sequence
CAAGCAGTTGCTTTCCTACAGCANAAATGAAAGGGGATAACCATTTTACCTACTGCTTGGTGATGGTGCACGTGTTAACT
TTTTAACCTAGCCTGGAAATGTATGTAATAACTCATGTAANATCAAGACAGCATCACACACAACAGAATCCTGTCTTCCA
TTACCCCATCCTTGTTTCTGAAAAGCCACTAGACATAGACCAATAAACTCCCTCANCCACCCCATCTAAAACCCGGANAG
CTCCGGATCTANTTTGAGCCTGCTGATGCCTGCCGAGGGGGGAGAANCAGGAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86399695..86399992 286
 
EST/CDNA Est Name
  AA790052.1 - AI159141.1 - BF021570.1 - BF452934.1 - CF623026.1


Sequence tag IST13660H10HMR1
Sequence
CTTGCTTGCTTTTCTTTTCTTTCTTTCTTTCTTTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTCTTTTCCTTT
CTTCCTTCCTTCCTCTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTC
TTTTAAATAAAGCAAGGCTTTTACCACAGCTGAACTTTTAACTTGAATAAACTGCCTGGCCGTTTTGCCTTCAGTTCCTG
AGGCAAAGGAAAGAACCANCAGATGTGTAGGCAGCACCCTGAACAGGGAGCCTGGGGGAGAGCANCCGCTTTCCCTTGGC
TTTANACTTCAAATAGCTCTTTGCCGCTGTGN
Sequence Type genomic DNA
Unitrap ID UNI14045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86399348..86399698 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es