Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15081C8
Clone ID IST15081C8
Vector VICTR80
Project tigm

Sequence tag IST15081C8HMF1
Sequence
CCATGTCCTCTCGTGGACCTTGATGTAACCCTTTAAACAGCATATTGAATTGTACTTCTTTCTCAGACGAAGAAAAAGCA
AAGTAACCCAGTCTTGGCTCCGGCCACACCCCAGAGTGGGGACAGCCTTCTGTGAGAGTTAAGGATACAGGATCAGCTCT
GAGATTCTGCTCCTTGCTACCCTGTGAAACTGTANACAC
Sequence Type genomic DNA
Unitrap ID UNI26834

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29988995..29989193 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043557 (Mdga1) NM_001081160 MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]


Sequence tag IST15081C8BBF1
Sequence
CCATGTCCTCTCGTGGACCTTGATGTAACCCTTTAAACAGCATATTGAATTGTACTTCTTTCTCAGACGAAGAAAAAGCA
AAGTAACCCAGTCTTGGCTCCGGCCACACCCCAGAGTGGGGACAGCCTTCTGTGAGAGTTAAGGATACAGGATCAGCTCT
GAGATTCTGCTCCTTGCTACCCTGTGAAACTGTAGACAC
Sequence Type genomic DNA
Unitrap ID UNI26834

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29988995..29989193 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043557 (Mdga1) NM_001081160 MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]

 
Come back to gene ENSMUSG00000043557


For any suggestions or comments, please send an email to unitrap@crg.es